The UMD Central
Insertions analysis

This option is used to check if a repeated sequence could be involved in the mutational event. In this hypothesis, a repeated sequence is created by the insertion process to complete a partially duplicated sequence.
For example the CGA sequence is inserted in the ctttctacgattaattaaggca and resut in ctttctacgattaaCGAttaaggca. the repated sequence created by the insertion process is cgattaa (ctttctaCGATTAACGATTAAggca).